turbofectin 8 0 transfection reagent (OriGene)
96
Structured Review
OriGene
turbofectin 8 0 transfection reagent
Turbofectin 8 0 Transfection Reagent, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 541 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/turbofectin+8+0+reagent/TurboFectin+8%2E0+Transfection+Reagent/pmc13219498-366-15-19
Average 96 stars, based on 541 article reviews
Turbofectin 8 0 Transfection Reagent, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 541 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/turbofectin+8+0+reagent/TurboFectin+8%2E0+Transfection+Reagent/pmc13219498-366-15-19
Average 96 stars, based on 541 article reviews
turbofectin 8 0 transfection reagent - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Transfection:Article Title: Expression of MIR155HG, LOC283856, KIAA0125, and LOC100190986 as potential prognostic and predictive biomarkers for breast cancer Article Snippet: MCF-7 cells were stably transfected with the empty expression vector pCMV6-Neo (empty vector) or containing the complete cDNA of the SPARC gene (pCMV6-SPARC) (Origene, USA). .. For the transfection assay, 1×10 5 MCF7 cells were distributed in 6-well plates, and after achieving the necessary confluence (60-70%), they were transfected using the Article Title: Human translesion DNA polymerases ι and κ mediate tolerance to temozolomide in MGMT-deficient glioblastoma cells. Article Snippet: An empty pCMV6 vector (OriGene, Rockville, MD, USA) was used as a negative control. .. Cells were grown to ~50 % confluence in 10 cm dishes and transfected with 10 μg of DNA, 250 μL of OPTI-MEM (Gibco, Thermo Fisher) and 24 μL of Article Title: Resolving the three-dimensional interactome of human accelerated regions during human and chimpanzee neurodevelopment. Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Article Title: P2Y 2 receptors mediate nucleotide-induced EGFR phosphorylation and stimulate proliferation and tumorigenesis of head and neck squamous cell carcinoma cell lines Article Snippet: Membranes were incubated in TBST with horseradish peroxidase-linked goat anti-rabbit IgG antibody (1:2,000) for 1 h at room temperature and protein bands were visualized using enhanced chemiluminescence reagent, detected on X-ray film and quantified using a flat-bed scanner and LI-COR Image Studio Software. .. Generation of P2Y 2 R-null cells using CRISPR/Cas9 CAL27 or FaDu cells were transiently transfected with a U6-gRNA:CMV-Cas9-GFP plasmid containing guide RNA directed against the human P2Y 2 R (5’- TACAGGTGCCGCTTCAACGAGG −3’) using Article Title: Role of interleukin-24 in the tumor-suppressive effects of interferon-β on melanoma. Article Snippet: This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record.. Please cite this article as doi: 10.1111/exd.13955 This article is protected by copyright.. All rights reserved. Article Title: Resolving the three-dimensional interactome of Human Accelerated Regions during human and chimpanzee neurodevelopment Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using CRISPR:Article Title: Resolving the three-dimensional interactome of human accelerated regions during human and chimpanzee neurodevelopment. Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Article Title: P2Y 2 receptors mediate nucleotide-induced EGFR phosphorylation and stimulate proliferation and tumorigenesis of head and neck squamous cell carcinoma cell lines Article Snippet: Membranes were incubated in TBST with horseradish peroxidase-linked goat anti-rabbit IgG antibody (1:2,000) for 1 h at room temperature and protein bands were visualized using enhanced chemiluminescence reagent, detected on X-ray film and quantified using a flat-bed scanner and LI-COR Image Studio Software. .. Generation of P2Y 2 R-null cells using CRISPR/Cas9 CAL27 or FaDu cells were transiently transfected with a U6-gRNA:CMV-Cas9-GFP plasmid containing guide RNA directed against the human P2Y 2 R (5’- TACAGGTGCCGCTTCAACGAGG −3’) using Article Title: Resolving the three-dimensional interactome of Human Accelerated Regions during human and chimpanzee neurodevelopment Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Clone Assay:Article Title: Resolving the three-dimensional interactome of human accelerated regions during human and chimpanzee neurodevelopment. Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Article Title: Resolving the three-dimensional interactome of Human Accelerated Regions during human and chimpanzee neurodevelopment Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Plasmid Preparation:Article Title: Resolving the three-dimensional interactome of human accelerated regions during human and chimpanzee neurodevelopment. Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Article Title: SOX2 utilizes FOXA1 as a heteromeric transcriptional partner to drive proliferation in therapy-resistant prostate cancer Article Snippet: .. We co-transfected in BiT plamids using Article Title: P2Y 2 receptors mediate nucleotide-induced EGFR phosphorylation and stimulate proliferation and tumorigenesis of head and neck squamous cell carcinoma cell lines Article Snippet: Membranes were incubated in TBST with horseradish peroxidase-linked goat anti-rabbit IgG antibody (1:2,000) for 1 h at room temperature and protein bands were visualized using enhanced chemiluminescence reagent, detected on X-ray film and quantified using a flat-bed scanner and LI-COR Image Studio Software. .. Generation of P2Y 2 R-null cells using CRISPR/Cas9 CAL27 or FaDu cells were transiently transfected with a U6-gRNA:CMV-Cas9-GFP plasmid containing guide RNA directed against the human P2Y 2 R (5’- TACAGGTGCCGCTTCAACGAGG −3’) using Article Title: Resolving the three-dimensional interactome of Human Accelerated Regions during human and chimpanzee neurodevelopment Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Cloning:Article Title: Resolving the three-dimensional interactome of human accelerated regions during human and chimpanzee neurodevelopment. Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using Article Title: Resolving the three-dimensional interactome of Human Accelerated Regions during human and chimpanzee neurodevelopment Article Snippet: .. For each CRISPR experiment, the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter, dCas9-VP64 and a gRNA cloning site, cat # GE100074; CRISPRi vector has a tGFP reporter, dCas9-KRAB-MeCP2 and a gRNA cloning site, cat # GE100085) according to manufacturer’s instructions, and transfection was carried out using other:Article Title: Activation of the α7 Nicotinic Acetylcholine Receptor Prevents against Microglial-Induced Inflammation and Insulin Resistance in Hypothalamic Neuronal Cells Article Snippet: To induce plasmid-driven overexpression of α7nAChR, the cells were transfected with pCMV6-entry plasmid carrying an |